jump to navigation

For current reasons: Burger King/Porn júní 29, 2006

Posted by herraheri in Herra the Heri.
6 comments

Dear search engine users and „Burger King Hechingen“ – freaks! I am very proud to be favoured by your visit! And I promise you, you didn’t click the link to my site for nothing!

Look, I’ve got all the stuff you’ve been dreaming of when you typed your search term at Google:

  1. Well, actually, I shouldn’t give that one away yet, but…whatever: Burger King Hechingen will officially open its doors on Saturday, June 30, 2007. The first 100 visitors will receive one Big King XXL for free! So rejoice and be there early! *
  2. You can find the perverted porn section at Pack a punch!

I hope I could help y’all! Thank you, come back!

Herra Héri!

By the way: Exactly 1 month to go…Iceland, we’re coming!

* Well, in fact, this opening date is fictive, and there are no Big King XXls to be given away. No one knows when the BK restaurant will open. Except today’s newspaper.

Auglýsingar

„Where are my people? They are all drunk!“ júní 26, 2006

Posted by herraheri in Herra the Heri.
4 comments

Hey! Today’s selection:

In memorian the mighty Socceroos who have been wrongfully beaten by rotten, magotty Italians this afternoon – Impressions from last week’s World Cup match Australia vs. Croatia (2:2) in Stuttgart. The party at Schlossplatz and around was really hillarious. Great atmosphere, great fun. Go there as long as you have the chance!

Theoder-Heuss-Strasse Mr.Beer in the house Croatia's going home

Theodor-Heuss-Street – Brazil Boom Boom – First victims

Public Viewing Socerooos! International Conversations

Public viewing area – Croatia’s going home – how symbolic

For more pictures of this memorable evening, including Cangoroo Jack and some Police photo shooting, check out bl-bilder.de.

Word.

One Flu over the Coocoo’s Nest júní 22, 2006

Posted by mlelephant in M. L'éléphant.
2 comments

Have you ever heard again of the avian flu since apocalyptic ideas have been spread in January and February this years. I know – we all bought our medication or at least have been offered some in particular emails. The hospitals are also packed with pills and potions to fight the evil bird-ridden disease. No more danger?

Unfortunately the bird flu is rather angry. Should its fame already be over? We talked to the notorious virus about disappointment, health care in the time of mass media and hideous plans for the future.

Please note – as Mr. Bird Flu is a virus it communicates by means of genetic acids which are combined in different ways. The acids are guanine, adenine, cytosine and thymine. We have added a translation for better understanding

Herra: Hello Mr. Bird Flu.

Bird Flu: ACCGGAAA TTCGGAATC (Good day, dear Heri)

Herra: How do you do today?

BF: TTTGGAA CCG (Not too good)

Herra: Why that? Anything wrong?

BF: TTTGGACCA GGACCAAT TTTTGGAACC CCTTGAAAAAAAAAA TTG (I am very angry)

Herra: I suppose you are angry because you don't get the attention you think you deserve. Aren't you motivated to infect birds anymore?

BF: TTGGAA CCGA AAT TTGC GGATC GGTCCC AAACC (It is not that I am not motivated to infect anymore, I am no more motivated to live)

H5N1 - talks to us
First blog to interview a virus…Mr. Bird Flu opens his dna a bit to talk to us about acids, feelings, and mass meda health care.

Herra: That sounds rather depressed. Have you ever considered to consult a psychiatrist?

BF: GTTGAAA CGGAA TTAATTTTTTTTAAC GGTCCAACTT AAAATTT CGTATCT AAAGTC AGGTTCA (Are you kidding? I am middle high middle. I am as mad as ten mad monkeys on mad potion. I am the ill-famed bird flu virus)

Herra: Let's keep in mind you are rather schizophrenic. Any plans for the future?

BF: AAAGTTTTCCC TTGGAAACCTTAAGA GGAATTTCCTTAA (Got some mutations going on. Release date is postponed, however – bad managment, you know)

Herra: Oh, that is too bad. Thanks for the interview. We hope you will extinct.

BF: GGTAAACTTTTAAACCTTTTAAAGGG (You impertinent mammal. You are lucky my ribosome hurts (aaaargh). Goodbye.)

And there he goes….. good night – don't forget: Birds are our friends!

Stuff júní 17, 2006

Posted by herraheri in Herra the Heri.
add a comment

Hello! Beautiful day for some pictures/videos, ain't it?

First, I've equipped the precedent post about the World Cup match France vs. Switzerland with some interesting pictures. Scroll down to feel it.

But not enough! On our World Cup-trip to Stuttgart we also took the perfect Herra Héri-promotion-picture in a natural environment. Check it out:

Simply Herra

Excited? I am, too! But it gets even better. On herra's pics, you can now watch three videos:

verruckt-am-atlantik.jpgIcelandic power – the classic

Precious momentsMelancholic Dublin

AbihuettenwahnsinnAbihuette 2006 – Insane

Have fun!

Good night, and good luck!

Crosstown madness júní 14, 2006

Posted by herraheri in Herra the Heri.
add a comment

Salut, mes chers amis!

Everybody speaks about football nowadays…and so do I.

Yesterday was the day Stuttgart and 52.000 other people, amongst them two lucky persons from Hechingen, let's say Mr.V and me had been waiting for the past year: The World Cup-match Switzerland vs. France, 13.06.2006, 18.00, Gottlieb-Daimler-Stadion, Stuttgart-Bad Cannstatt.

cheese

We had been a little afraid of the complete loser-game that a match like this promises, but we managed to convince us that we would get to see a great match with everything one can imagine for a World Cup. And it began great: thousands of insane Swiss Fans, chanting "Schwiizer Nati!" (quite awkward, shouted out by hundreds of people, especially when the "t" sounds like a "z"), amongst them a few intimidated French Fans; some desperados stood around with poor signs: "I need ticket" – that's the true World Cup-feeling!

Still hoping

So yes, we were quite euphoric. Even the fact that they took our "Herra Héri"-sign ("Des brennt doch, des kommt it mit nei!" – revenge will follow!) at the entrance and that the organization was a veritable mess (no alcohol-free drinks, the ticket automats didn't work) didn't cloud our sunny mood. Until the game started.

Losing Hope

MAN, it was bad. Probably the worst game I've ever seen in a stadium. The French team seemed too bored to do something and the Swiss Team, well…they appeared to be at their limits. Bonjour tristesse. After 10 minutes, we knew that this game would end without goals. After the first half, we thought it couldn't get worse. They teached us the contrary in the second half. It hurt. I cried. Yet, the ~40000 Swiss Fans around us were partying.

Hopp Schwiiz!

Well, you can't always get what you want.

After the match, we headed for the Schlossplatz to watch Brazil vs. Croatia. On and around the place there were at least 40,000 people from all nations enjoying themselves. It was overwhelming. Let's not talk about the historically embarrassing stage show. When the last game of the day was over, the party on Theodor-Heuss-Strasse began. Hundreds of predominantly Croatian fans blocked the streets, jumped upon and shook cars, honked and flirted with the police while the Brazilian fans did some Samba action hundred meters away. International party, international understanding. It's undescribable. Priceless. If you like football or not, you DO need to join this huge party at least once. You have about 20 chances left.

Party

Photos will follow on Friday – now I have to prepare myself for the German match this evening.

To conclude this post, may I invite you to read the precedent post and a) acquire some herra héri-gear and b) come to Fecker tomorrow at 5.00 pm? Good.

Chao,

Herra.

Let there be Funk júní 11, 2006

Posted by herraheri in Herra the Heri.
add a comment

Hæ!

Whatup, hoes. The weather surely was our mate. It was one great idleness. Formidable.

Remember the gig of this nameless band at Fecker that had been cancelled a few weeks ago because of basinal accidents? Well, the basin and the hands have been fixed! Now nothing (besides a proper name) stands in the way of this glorious gig. So:

Come to the Fecker-tavern on forthcoming Thursday, June 15th, at 5 pm. As the weather will be great (we've become good friends), we will play in the sunny beer garden of the pub. What awaits you is some good old-school Funk plus concentrated Soul-power. It's gonna be as free and beneficial as it was supposed to be. We will show you that 11 people don't necessarily have to be playing football, even in these hard times.

At this place, I would like to remember you of the great opportunity to purchase one unique herra héri piece of clothing at affordable prices. Give me a shout until Thursday and I will arrange that the anti-capitalist sewing-machine will run amok for you, too! And, to give you an impression what this shit will be looking like, I authorized a professional model with the perfect body to do a little shooting. Have a look at the impressive results:
herra! I looove sports! I'm boring

the herra héri logo – herra for sport-addicts – herra for bourgeois

BIATCH!big it up!

herra for gangstaz.

This examples are part of the first herra héri-collection. This time, the logo will be red/beige/black instead of yellow/white/black. Check the precedent post for more details! The chances are that there will be a fascinating Herra Héri World Domination Package included with every item ordered. With this one, you will have the power to become a Herra Héri-activist and recruit more people all over the world. Be surprised!

Join the Movement, dude!

Herra Héri!

Voodoolicious – Get your own Herra Héri apparel! júní 5, 2006

Posted by herraheri in Herra the Heri.
add a comment

Ahoy!

Your life is boring? You don't have any friends? Your parents dislike you? You had your favourite pet for dinner? Diverse parts of your body are rotten because of these permanent injections? Rat poison isn't as lethal as it used to be? –

Well, I'm sorry I can't help you. But I have something for you that will really maybe uplift your mood: The fresh and funky new Summer/Autumn '06 clothing series by Herra Héri which you can order at "info (at) herraheri.de" now! The clothes come with the original herra héri-logo in red and beige (embroidered).

This time you can order

  • T-Shirts (men or women); colours: black, white, tinged with grey, dark blue, yellow.
  • Polo-Shirts (men or women); colours: black, white, dark blue.
  • Hoodies (men only); colours: black, tinged with grey, dark blue. 

All pieces are available in all sizes. 

Sir Zorc Wotan-approved!

Grab this once-in-a-lifetime-opportunity and order your Herra Héri-Shirt/Hoodie now! Order busy, order a lot! All pieces include a life-long warranty for the happiness of the customer (no suicide candidates). Herra Héri – fresh clothing for fresh people!

So, write an email to "info (at) herraheri.de" or just contact me personally until Thursday, June 15th.

I'm off for the next week, camping in France (if the weather is our mate). Have a nice week and stuff.

Baguette!

Accidents happen júní 4, 2006

Posted by herraheri in Herra the Heri.
add a comment

Hey there!

Some bizarre things happen these days. You have to check this out:

Guy Goma, expert in points of law in the internet

And, for satan's sake, watch the video! Yesterday, I spent the whole day laughing about this…hillarious!

And I have another one for you: Last week some unknown persons spread these (faked) letters with some crackbrained demands concerning the district around the football stadium in Köln during the World Cup:

Fifa-Checkliste.jpgkölnamtsrede.jpg

These persons presumably also cloned the official FIFA-WM Website of Köln and provided these letters for download. There was a similar campaign in Dortmund:

dortmundamtsbrief.jpg

The sad thing about this funny stuff is that it is not this unreal at all:

These restrictions are a reliable indicator that the FIFA has gone crazy.

If you're too rotten for clicking these three pics and read the small script, click this link and you will get the whole thing on a silver plate.

Keep it unreal!

Herra Héri!

Things you always wanted to know about Iceland (1,5) júní 1, 2006

Posted by herraheri in Icelandic Culture.
1 comment so far

Are you ready for some Icelandic music? Alright, let's do this.

Check out Hot Damn! This Icelandic rock group performs the quite promising title Hot damn, that woman is a man! You can download the mp3 on this site for free along with some other songs. (There is also a video, but sadly it's quite large (36mb). The vid is about a fucked-up party with lots of light beer, Jack Daniels, cigarettes and plenty of theatrical guitar playing. Whatever. There is also a smaller version of the video (15mb).

For all Icelandic music you can think of, go to smekkleysa.net (Bad Taste). This Icelandic label releases pretty much every Icelandic recording and supplies the whole world with the stuff.

If you have a really good musical taste, you surely noticed Iceland's appearance at the Eurovison Song Contest: Silvía Nótt (that is Silvía Night). No, she is not the new starlet on porno-heaven, she just seems to be the greatest bitch ever: In the run-up to the Song Contest, she called the Dutch group Treble sluts and prostitutes. Other bad words like "fucking amateurs" and "retards" were dropped in conjunction with the sound engineers in Athens. In the course of a press conference, a journalist who dared to look her in the eyes was packed out of the room by one of Silvías bodyguards. Her song Til hamingju Ísland (Congratulations Iceland) was, all in all, about how great she is ("Hello, is it God? What up dog? It's Silvía, your favourite person in the whole world!") – she didn't make it to the finale. Visibly shocked, she threatened to jump of a building, called the Swedish singer an "ugly fucking old bitch" and the Finish winners "ugly people from Finland without a real make-up artist". She also announced to sue a journalist, a TV-Station and whole contest.

Silvía Night

On the whole, pretty amusing stuff. Everybody was pissed. But what nobody knew: Silvía Night is just a fictive person played by Ágústa Eva Erlendsdóttir for an Icelandic comedy show. She is the singer of the "normal" Icelandic band Ske. If you're asking me: Great fun. She plays the role so perfectly, you have to detest this character.

Visit the following links for more details:

So much for today.

Bless.